ZM_BFzz
back


 
 
This Zea mays (maize) FULL_LENGTH_cDNA_Rearrayed library was constructed by AGI. It was constructed in the EcoRV site of pCMV.SPORT-6.1 and contains 36096 clones (94 plates). The tissue type is mixed. The development stage is mixed. The library can also be referred to as rearray_FLcDNA_2_3.
Marker - Ampicillin
Vector - pCMV.SPORT-6.1

This library is the rearray set of FLcDNA selected from the maize FLcDNA project www.maizecdna.org . Not all wells are usable-- the complete nomenclature of the FLcDNA set can be downloaded from here: http://www.genome.arizona.edu/orders/Final_maize_FLcDNA_2-3-10.xls The library was size-treated during construction to reduce the amount of small size cDNAs since most small size fragments are truncated either prior or during cDNA synthesis. It is possible that some small RNAs/cDNAs (<500bp) might be excluded from the library. Use EcoRI and NotI for insert checking. FWD primer: M13F: GTAAAACGACGGCCAGTG(5prime - 3prime). REV primer: custom: AGCGGATAACAATTTCACAC (5prime - 3prime). Cost of whole library is $10,000 for public research institutions; for companies, please inquire.
Buy This
Item Qty Unit Price* Total
Clone** (clone addresses) $
Filters are available. Please inquire about pricing and availability.

 
*Prices are for academic, government, and non-profit groups only. Company prices are $50 for clones and $250 for filters. Company prices for vectors and entire libraries vary, so inquire about pricing and availability before placing an order for vectors and libraries.

** MTA Letter Required For Transfer.
Please complete the appropriate MTA and FAX to 520-621-1259.

Signatories to the (NIH) Uniform Biological Transfer Agreement should download the UBMTA pdf file.

For clones/libraries from the UCDavis Lettuce and Sunflower projects the LettuceSunflwr MTA MUST be used.

Commercial customers and institutions that are not signatories to the UBMTA, please download the BMTA_4-16-08a pdf file or contact Dave Kudrna to receive the appropriate MTA by fax.

 
 


© Copyright 2002 Arizona Genomics Institute